logo
Affymetrix Probeset: MED4_ARR_1823_x_at
Probeset Position: 349978..350002(-)
Number of probes: 1

Microarray Data of MED4_ARR_1823_x_at

Project Exp Time mean(T) mean(C) ratio(T/C) log2(T/C) q
Iron Availability -Fe 0 h NA NA None -0.314733 0.896712
Iron Availability -Fe 12 h NA NA None 0.861558 0.005471
Iron Availability -Fe 24 h NA NA None 0.860764 0.001289
Iron Availability -Fe 48 h NA NA None 1.158983 4.9e-05
Iron Availability -Fe 70 h rescue NA NA None -1.217591 0.000108

Protein Info: PMED4_03962
COG

Location: 349962 - 350051 (-) on scaffold: NC_005072
Protein Length: 30 aa

Genome: MED4
NCBI ID: None
Locus Tag: PMED4_03962

MicrobesOnline ID: VIMSS5163157
CyCOGOrphan: 0(ID from pipeline) - None (ID from previou versions)
CyCOGOrphan Size: 8908

Submit BLAST to NCBI
nr (BLASTp)
nt (BLASTn)
Affymetrix Probeset: MED4_ARR_1823_x_at
Diel FDR ( cutoff=0.1 ): 0.000858
Is Expressed: True

GO Annotations from ARGOT2 (total Score, internal_confidence, information_content)
GO ID GO Aspect GO Term Total Score Internal Confidence Information Content
None None None None None None

GO Annotations from CAMERA
Protein GO ID Pfam ID Description E-value
None None None None None

Pfam Annotations
Protein Pfam ID Name Description E-value
None None None None None

Enzyme Information
Protein EC Number Note
PMED4_03962 NA Annotated previously

>PMED4_03962
MPLDVFLINMCVVVLGLLVRREIKLRKARX

>PMED4_03962
ATGCCATTAGATGTTTTTCTAATAAATATGTGTGTTGTAGTTTTAGGTTTACTTGTCAGAAGAGAAATCAAACTTAGGAAAGCCAGATAG